Skip to main content

Table 1 List of genes and primer sequences used for qRT-PCR

From: The involvement of interleukin-22 in the expression of pancreatic beta cell regenerative Reg genes

Gene symbol Forward primer (5’→3’) Reverse primer (5’→3’) Product size (bp)
Reg 2 cactgccaaccgtggttat gacaaaggagtactgtgcctca 75
Reg 1 catctgccaggatcagttgc aggtaccataggacag 549
Reg 3δ (INGAP) ccatggtgtctcacaagacc tgatgcgtggagaagacagt 117
IL-22 tcagctcagctcctgtcacat tccccaatcgccttgatctct 117
IL-22R α gctcgctgcagcacactacca tctgtgtcgggagtcaggcca 247
β-actin gcccagagcaagagaggtat cacacgcagctcattgtaga 116