Skip to main content

Table 2 Primer sequences used for real-time RT-PCR

From: Consistent apparent Young’s modulus of human embryonic stem cells and derived cell types stabilized by substrate stiffness regulation promotes lineage specificity maintenance

Gene Forward (5′-3′) Reverse (5′-3′)
OCT4 CTTGAATCCCGAATGGAAAGGG GTGTATATCCCAGGGTGATCCTC
NANOG TGGGATTTACAGGCGTGAGCCAC AAGCAAAGCCTCCCAATCCCAAAC
FOXA2 GGAGCAGCTACTATGCAGAGC CGTGTTCATGCCGTTCATCC
SOX17 CTCCGGTGTGAATCTCCCC CACGTCAGGATAGTTGCAGTAAT
AFP TGTACTGCAGAGATAAGTTTAGCTGAC TCCTTGTAAGTGGCTTCTTGAAC
PROX1 CAGATGGAGAAGTACGCAC CTACTCATGAAGCAGCTCTTG
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG