Skip to main content

Table 1 Realtime-qPCR primer

From: Forkhead box family transcription factors as versatile regulators for cellular reprogramming to pluripotency

Gene Forward primer Reverse primer
Gapdh AACTTTGGCATTGTGGAAGGGCTCA TTGGCAGCACCAGTGGATGCAGGGA
Oct4 CATTGAGAACCGTGTGAG TGAGTGATCTGCTGTAGG
Nanog CTCAAGTCCTGAGGCTGACA TGAAACCTGTCCTTGAGTGC
Dppa5a CCGTGCGTGGTGGATAAG GCGACTGGACCTGGAATAC
Sox2 AGGGCTGGGAGAAAGAAGAG CCGCGATTGTTGTGATTAGT
Sall4 CTAAGGAGGAAGAGGAGAG CAAGGCTATGGTCACAAG
Rex1 CAGCCAGACCACCATCTGTC GTCTCCGATTTGCATATCTCCTG
Twist2 AGATGACCAGCTGCAGCTAC ATGTGCAGGTGGGTCCTG
Esrrb TTTCTGGAACCCATGGAGAG AGCCAGCACCTCCTTCTACA
Cdh1 CAGCCTTCTTTTCGGAAGACT GGTAGACAGCTCCCTATGACTG
Epcam CTTGTGTCTGCACGACCTGT CCAAGCATTTAGACGCCAGTTT
Dusp5 GCCACCATCTGCCTTGCTTAC ACTCCGCCTCTGCTTCACAA
endo Sox2 TGCGCCCAGTAGACTGCAC ACCCCTCCCAATTCCCTTGTAT
endo Oct4 TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC